ResearchCharacterization of H 5 N 1 influenza viruses isolated from humans in vitro

Since December 1997, highly pathogenic avian influenza A H5N1viruses have swept through poultry populations across Asian countries and been transmitted into African and European countries. We characterized 6 avian influenza H5N1 viruses isolated from humans in 2004 in Thailand. A highly pathogenic (HP) KAN353 strain showed faster replication and higher virulence in embryonated eggs compared to other strains, especially compared to the low pathogenic (LP) SP83 strain. HP KAN353 also showed strong cytopathogenicity compared to SP83 in Madin-Darby canine kidney cells. Interestingly, LP SP83 induced smaller plaques compared to other strains, especially HP KAN353. PB2 amino acid 627E may contribute to low virulence, whereas either PB2 amino acid 627 K or the combination of 627E/701N seems to be associated with high virulence. The in vitro assays used in this study may provide the basis for assessing the pathogenesis of influenza H5N1 viruses in vivo. Introduction H5N1 avian influenza viruses are a causative agent of outbreaks of fatal disease in poultry worldwide, and a cause of fatal infection in humans with a more than 50% mortality rate since 1997 [1,2]http://www.who.int/csr/disease/avian_influenza/country/cases_table_2009_08_11/ en/index.htm. Despite culling of all poultry on farms and probable eradication of the index genotype, novel genotypes have emerged [3]. Since 2004, the Z genotype has become dominant and spread to Southeast Asian countries including Thailand, Vietnam, Cambodia, and Laos [1]. Recently, genotype Z H5N1 viruses have been detected in domestic and wild birds in Central Asia, the Middle East, Africa and Europe, and migratory waterfowl have been implicated in the geographic expansion of the disease [4]. As of August 2009, the cumulative number of confirmed human cases of avian H5N1 influenza reported to the WHO was 438, 262 of which died http:// www.who.int/csr/disease/avian_influenza/country/ cases_table_2009_08_11/en/index.htm. It is important to elucidate the genetic determinants that allow cross species transfer of avian influenza viruses into mammalian populations and to elucidate the molecular basis of the pathogenicity in mammals, since H5N1 viruses isolated from humans in 1997 showed different virulence to mice [5-7]. Katz reported that 9 of 15 H5N1 viruses isolated from humans in Hong Kong in 1997 were highly pathogenic (HP) to mice, whereas 5 of them exhibited a low pathogenic (LP) phenotype, replicating only in the respiratory tract without mortality. The remaining one strain showed an intermediate pathogenicity phenotype [7]. All 15 viruses shared a multi-basic amino acid (aa) motif at the cleavage site between HA1 and HA2 which was lethal for experimentally infected chickens [5,8,9]. One of the HP H5N1 viruses, A/Hong Kong/483/97, contained lysine at aa position 627 in the PB2 protein, whereas one of the LP H5N1 viruses, A/Hong Kong/486/97, contained glutamic acid at the same position, demonstrating that a single aa residue at position 627 was a key molecular determinant for virulence in mice [10]. However, when PB2 aa sequences were compared among the HP H5N1 viruses, only three of the 9 HP H5N1 viruses contained a lysine at PB2 aa residue 627 (627 K) [11,12]. Thus, PB2 aa 627 K alone did not correlate with lethality in mice, suggesting that other genetic variations were involved in virulence in mice but that this residue could not affect replicative efficiency in mice [13]. * Correspondence: yonggang@biken.osaka-u.ac.jp 1 Section of Viral Infections, Thailand-Japan Research Collaboration Center on Emerging and Re-emerging Infections, Tiwanon Road, Muang, Nonthaburi 11000, Thailand Full list of author information is available at the end of the article Li et al. Virology Journal 2010, 7:112 http://www.virologyj.com/content/7/1/112 Page 2 of 7 The high cleavability of the hemagglutinin glycoprotein (HA) was essential for lethal infection in birds, suggesting that the HA protein also plays an important role in the HP phenotype in humans. As HA mediates viral binding to host cell sialic acid-specific receptors and the subsequent fusion of the membrane of the endocytosed virus particles with the endosomal membrane leads to the release of vRNP into the cytoplasm, the cleavage site is associated with H5N1 pathogenicity [10]. Other studies suggested that 92 E of the NS1 protein is important for abrogating the antiviral effects of interferon and tumor necrosis factor alpha, and may be crucial to the pathogenicity in pigs [14]. A recent study demonstrated that aa residue 66 S of PB1-F2 affects the pathogenicity of an H5N1 virus in mice [15]. Since the SP/83/04 (SP83) strain isolated in Thailand in 2004 is LP to ferrets and mice in vivo, and the KAN/353/ 04 (KAN353) strain isolated in Thailand in the same year shows HP to ferrets [16], we used these viruses to characterize in vitro phenotypes associated with the pathogenicity in animals. We also used four H5N1 viruses isolated in Thailand in 2004 from humans. Although a reverse genetics system and animal experiments are needed to confirm the segments involved in the virulence, comparison of the in vitro phenotype described in this study may provide the basis for assessing the pathogenesis of influenza H5N1 viruses in vivo. Materials and methods Viruses and cells Six H5N1 influenza viruses, SP83, KAN353, Thai/1623/ 04 (Thai1623), KK/494/04 (KK494), PCBR/2031/04 (PCBR2031), and SP/528/04 (SP528), isolated from humans in Thailand in 2004 were used in this study. The viruses were isolated with MDCK cells and grown once in 10-day-old embryonated chicken eggs. The allantoic fluid was used as the virus stock. MDCK cells were maintained in MEM supplemented with 10% newborn calf serum and antibiotics at 37°C in 5% CO2. All experiments were performed in a biosafety level 3 containment laboratory. Plaque assay To measure the virus infectivity, we performed a plaque assay as described previously [17]. Briefly, MDCK cells were plated at 6 × 105/well in 6-well microplates one day before the assay. The confluent cells were infected with serial 10-fold dilution of virus samples and incubated for 1 hr at 37°C with shaking every 15 min. The cells were washed with phosphate-buffered saline (PBS) and covered with 1% agarose in a 2 × MEM medium containing 5 μg/ml of TPCK-trypsin (Sigma, Missouri, USA). After incubation for 3 days at 37°C, the agarose was removed and the cells were fixed with 10% formaldehyde and then stained with 0.1% crystal violet to visualize the plaques. The infectivity titer was expressed by plaque-forming units (PFU). Real-time PCR The viral RNA was extracted from the culture medium of MDCK cells or allantoic fluid by using a QIAamp viral RNA Mini kit (QIAGEN, Hilden, Germany). The RNA was reverse-transcribed to cDNA by using random primers (Invitrogen, Oslo, Norway). We used 5-μl portions of cDNA to amplify the M gene by real-time PCR using a forward primer A/M264R2 (5-ACAAAGCGTCTACGCTGCAG) and a reverse primer A/M30F (5TTCTAACCGAGGTCGAAACG) as described previously http://www.nih.go.jp/niid/index-e.html (in Japanese). The amplification was performed by using SYBR Green (ABI, Warrington, UK) according to the method described previously [18] with slight modifications. The pretreatment of the reaction was carried out at 95°C for 10 min, then subjected to 40 cycles of amplification at 95°C for 15 sec and at 60°C for 1 min. Virus infection to embryonated eggs Ten-day-old embryonated eggs were inoculated with the viruses and incubated at 37°C. The dead eggs were checked every 12 hours. PBS was used as the negative control. After 24 hours of infection, allantoic fluid was used for the virus titrations by plaque assay. Sequence analyses Viral RNA extracted with a QIAamp viral RNA Mini kit was used in a one-step reverse transcription PCR (QIAGEN). The PCR products were cloned into the pGEM-T Easy Vector System (Promega, Madison, USA). The plasmid was extracted with the GenEluteTM Plasmid Miniprep Kit (Sigma) and used for sequencing by the ABI BigDye terminator cycle-sequencing kit with an ABI 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Amino acid sequences were analyzed by BioEdit.