Detection of human herpesvirls-6 dna seqeence in chinese lymphoma tissue by polymerase chain reaction

Since the isolation of human herpesvirus 6 (HHV 6) from perpheral blood on uimionur lenr r ci Is (l'EWO i.f jüi ! icnis i l h AIDS ;ni-i l vuiphoiüol i ffi-fit i vi' disoninrs in li-JHfi, un fi'i'ut i Im s born aiadi- to uruh-i-Mririct iiu1 pi,ssiM' fMtiKigt-nic i'l- "f this iirus in humai! l : - ,!. Uiiuanish et a L dtscovcml r h t HHV 6 C.IUM tl rxanth(-;i siiln i UPI. Unifier, ihe [)(. Lruio of rclaled rjistfu.st's ai c ilill uiichfüj, (.-s-pcrui! l. tiir rolt1 ni' IIIIV-6 irifeclinii in human lyiuphoiuii. In this report, the ||f|V (i specific UNA SfsquejK-f- was invest igtitcd in Chuuisi' i vniphoaia t IS.MK-K by poivnieraT chain reaction CPCK). The .source viral DNA was OS srrwin of HHV H passaged in HSB2 relis, which was kindly provided by the National Canrer Institute, (SA. The Niiain of HHV 6 (V-ltiK i.solntl in China, was cultured with rurd blood lyiuphocyu-s (C'BI.) nrlivod lv PflA. The gt-nome DNA of HSB2 and CBL cells with or without infect ion uf HHV fi. were extracted and amplified a.s template by PL'R. The prinei1.1- (A: 5' GATCCGACGCCTACAAACAC :i'; C: S' -CGGTCTrACACAGCATGAACTCTC r }. which amplificatPd the 830 bp fraRinent of HHV-6. pre kindly fis a gift by Pasi PCR tust itute, Franc. 52 .spec im tin s of paraffin - eiabedricd lymphoiua T. issue wp.rc cxiim muted presence of HHV 6 DNA sequence by PCK. HJIV 6 DNA si-quwice way detected in 6/21! (27.4%) non-Hodgkin'.s Iviuphoma (NHU. 8/15 (53.3%) Hotfgkin'.s lyiuphoiua.s(Hft) and 7/15(46.7%) unclassified ])Mphuma cases respectively. Total posh he rat- as ul/52 (40. 4%). As control. HHV-6 DNA -.c-qnrnre wa.s dPtiTted in 8/43(18.6%) peripheral blood smiples fron normal blond donors. The di (Terence1 was stat i.st ical I y signi f icaui (P0. tb) when normal biood donors were conpared itii J ymphoa cases. We ai so found HHV fi viral DNA from 2 Chinese cell lines: J6 1 and S 801 which appeared HD or lympfronia cell c.harac.1 L'rist ics respectively. These cell lines were1 established in China in 1970's. Ths(;.s results suggested that HHV (S might have relations with lyiuphoiuas, especially Hodgkm's Disease in China.