Oropouche fever epidemic in Northern Brazil: Epidemiology and molecular characterization of isolates

Results Real-time-PCR showed high titers of OROV in acute-phase serum samples from febrile patients. From 113 of 119 acutely febrile patients with paired serum samples, OROV infections was confirmed by serologic conversion ( n = 76) or high titers ( n = 37) for both HI and IgM-ELISA. Patients had a febrile disease characterized by headache, chills, dizziness, photophobia, myalgia, nausea, and vomiting. Females and children under 15 years of age were most affected. Nucleotide sequencing of six OROV isolates identified that genotype II was associated with the human disease epidemic. Conclusions Oropouche fever, which has re-emerged in the Bragantina region in eastern Amazon 26 years after the last epidemic, is caused by genotype II, a lineage previously found only in Peru and western Brazil. Keywords Oropouche fever Epidemic Re-emergence Epidemiology Molecular characterization 1 Introduction Oropouche virus (OROV), a single-stranded, negative sense RNA virus of Bunyaviridae , genus Orthobunyavirus , 1 which is the etiologic agent of Oropouche fever, is transmitted between humans in urban areas by the biting midge, Culicoides paraensis . 2,3 OROV was first isolated in the Brazilian Amazon in 1960 from the blood of a sloth ( Bradypus trydactylus ), following its original isolation in Vega de Oropouche County in Trinidad in 1954. 4 Its epidemic potential was recognized during an outbreak in Belem, Pará state (Brazil) in 1961, where approximately 11,000 people were infected. 5 Dozens of epidemics of Oropouche fever were recorded over the next 45 years in Northern South America, with an estimated half million cases. 3 Oropouche fever and OROV have been recognized in Trinidad, Panama, Peru and Brazil, and as an important public health concern in tropical areas of Central and South America. 3 Members of the genus Orthobunyavirus have a tripartite, single-stranded, negative sense RNA genome. The segments small (S), medium (M), and large (L) encode the nucleocapsid, the glycoproteins, and the RNA polymerase, respectively. Phylogenetic analysis of the nucleocapsid (N) gene of different OROV strains has defined three distinct genotypes (I, II and III) currently circulating in Central and South America; genotypes I and II have been previously detected in the Brazilian Amazon. 8,9 In the current study, we report an epidemic in the Magalhães Barata municipality that spread to neighboring municipalities of Igarapé Açu, Maracanã, and others within eastern Pará State, an area that has not had an Oropouche fever epidemic since 1981. 2 Materials and methods 2.1 Study sites Magalhães Barata situated in the Bragantina region of Pará state, is about 138 km east of Belém ( Fig. 1 ). It has approximately 6000 inhabitants, 2000 of them in the urban area. The climate is tropical, with high temperatures ranging from 22 °C to 35 °C, and the rainy season occurring between January and July that brings 2000–2800 mm of rainfall per year. The main productive activities include cattle grazing, fishing, and cultivation of manioc, pepper, and other specialties. Many people live under poor conditions. Maracanã municipality (47°32′W; 0°42′S) is located in the same region and is 163 km from Belém. Of its 35,000 inhabitants, 17,000 of them live in the urban area. Productive activities are similar to those of Magalhães Barata municipality. 2.2 Collection of samples Between 29 May through 30 June, 2006, 651 and 93 serum samples were obtained from residents of Magalhães Barata, and Maracanã municipalities, respectively as follows: 231 and 47 were from patients reporting an acute disease with fever lasting up to 5 days; from 119 patients (95 of Magalhães Barata and 24 of Maracanã), convalescent phase serum samples were also obtained. A serologic survey was also conducted from 465 people (420 from Magalhães Barata and 46 from Maracanã) reporting a febrile illness one to several weeks prior to blood collection. 2.3 Virus isolation Isolation of virus from acute blood samples was attempted in suckling mice (2 days) using a 1:10 (v/v) suspension of serum samples in phosphate-buffered solution (PBS) pH 7.4 containing penicillin (100 U/mL) and streptomycin (100 μg/mL) as described elsewhere. 10 50 and 35 blood samples taken from acute febrile patients from Magalhães Barata and Maracanã, respectively, were used to infect suckling mice. An additional 9 acute febrile blood samples obtained from sick persons from Igarapé Açu municipality were also inoculated in the same system. 2.4 Serological tests Serum samples were tested by hemagglutination inhibition—HI and IgM-ELISA for detection of specific HI and IgM antibodies to OROV as previously described. 11,12 2.5 Molecular characterization of OROV isolates Six isolates were selected for molecular analysis, two from each municipality as follows: Magalhães Barata (Brazil 2006a, Brazil 2006b); Maracanã (Brazil 2006c, Brazil 2006d); Igarapé Açu (Brazil 2006e, Brazil 2006f). Viral RNA was extracted from Vero cells infected with the human serum samples after showing at least 75% cytopathic effect, and the N gene (SRNA) was amplified using a one-step RT-PCR assay and a pair of primers ORO N5 (AAAGAGGATCCAATAATGTCAGAGTTCATTT) and ORO N3 (GTGAATTCCCACTATATGCCAATTCCGAATT) previously described. 8,9 Phylogenetic trees were constructed for N gene nucleotide sequences using neighbor-joining 13 and Maximum-Parsimony 14 methods implemented in the programs Mega 2.1 15 and PAUP 4.0. 14 Bootstrap analyses were performed on 1000 replicates to generate confidence in groupings. 16 The current sequences were compared with OROV N gene sequences available in the GenBank database ( Table 1 ). 3 Results Fifteen OROV strains were isolated, 9 from Magalhães Barata, 4 from Maracanã, and 2 from Igarapé Açu after inoculation of 94 blood samples in suckling mice. Identification of isolates was done by complement fixation (CF) test as previously described. 10 All virus isolates were confirmed by PCR. From 136 residents in Magalhães Barata with an acute febrile disease (up 5 days of onset) from whom a blood sample was taken, 52 were from the urban area and 84 from rural areas, a total of 38 (73%) and 54 (64.3%) were positive by HI and IgM-ELISA tests, respectively. The number positive by at least one test was 92 (68.1%). From 47 serum samples obtained in Maracanã municipality, with similar characteristics but all of them from rural areas, 32 (66.6%) had HI and anti-OROV IgM antibodies by ELISA. From 119 patients with paired samples (95 from Magalhães Barata and 24 of Maracanã), 76 serologic conversions were obtained by IgM ELISA and/or HI. Another 37 infections were confirmed by IgM ELISA positive and high HI titers (≥320) in both serum samples. Thus 113 (95%) people with paired samples had evidence of recent OROV infection. The age of 112 patients was known. All age groups were affected, but the most and the least affected groups were between 5–14 and ≥55 years of age (47.7% and 2.7%, respectively): 57.5% of all positive patients were people under 15 years of age ( Table 2 ). In both municipalities, patients showing clinical symptoms suggestive of Oropouche fever ( Table 3 ) were predominantly females (57.1%). The symptoms most frequently reported were fever (100%), headache (99.1%), chills (59.3%), and myalgia (46.9%), which is similar to that observed in previous outbreaks. 2,3,12,20 Serologic survey among 465 people reporting febrile disease at least 20–30 days before sampling was undertaken in the urban and rural areas of Magalhães Barata ( n = 422) and rural areas of Maracanã ( n = 45) municipalities. This indicated that 323 (76.7%) had specific HI antibody and 33 (73.3%) had IgM-ELISA antibody. Twenty-one (17 and 4, respectively from Magalhães Barata and Maracanã) were only positive by HI, and 16 (15 and 1, respectively) were only positive by IgM-ELISA. The positive test with a single antibody assay on sera from these 37 patients were confirmed by repeat testing. Based on the overall OROV positivity obtained by serology, virus isolation, and PCR, the estimated incidence for Oropouche fever virus infection was 76.9% in Magalhães Barata (∼4000 cases) and 73.3% in the rural area of Maracanã (∼13,000 cases), indicating that at least 18,000 cases of OROV infections occurred in the 2006 epidemic of Oropouche fever. The full-length SRNA of all six OROV strains which were genetically characterized ( Table 1 ) presented 714 nt in length and are predicted to encode two overlapping open reading frames, the nucleocapsid (N) and a non structural (NSs) protein of 693 nt (231 aa) and 273 nt (91 aa), respectively. Furthermore, two small non-coding regions were also found at the 3′ and 5′ ends from nucleotide positions 1 to 44 and 741 to 754, respectively. Phylogenetic analysis comparing Brazil 2006a–f isolates with other OROV strains from different geographic regions in South and Central America grouped strains of the present epidemic into the same clade of OROV genotype II ( Fig. 2 ). 4 Discussion Oropouche fever is the most widely distributed arboviral disease in the Brazilian Amazon after dengue fever, and is estimated to have infected at least half a million people since the first epidemic was recognized in 1960. Prior to the 1980 epidemics Oropouche fever was described only in this area. 3 OROV has subsequently spread to other Amazonian states, including Acre (1996), Amapá (1981), Amazonas (1981), Rondônia (1991) and Tocantins (1988); to a non-Amazonian state, as observed in 1988 in Maranhão in the Northeast region 2,3,12 ; and to other countries, such Peru and Panama. 3,7 In addition, between 1980 and 2005, sporadic cases or self-limited outbreaks of Oropouche fever have been reported in the Brazilian Amazon region and the Peruvian Iquitos region, suggesting silent, endemic circulation of the virus. 6,7,18,19 In 2006, several cases of Oropouche fever were detected in at least six municipalities in the Bragantina region, Pará State, an area with 30 municipalities and over one million inhabitants. This region reported a large epidemic between 1979 and 1980, when at least 20 municipalities were affected and 110,000 infections were estimated based on sero-epidemiologic surveys [20] . In the present outbreak, the first cases were recognized in April in Magalhães Barata. Some weeks later cases were detected in June in Igarapé Açu and Maracanã municipalities, and in August in Curuça, Marapanim, and Viseu municipalities. The frequency of cases diminished with the cessation of rain in the Bragantina region. This epidemic occurred 26 years after the last one 20 in the area and apparently was limited by the cessation of rain. Arbovirus epidemics have been temporally associated with rain and other climatic factors that play lead to an increase in the hematophagous insect vectors of arboviruses. 21–23 In Kenya several Rift Valley fever epidemics were associated with abnormally high rainfall 21 ; similar findings were observed during a jungle yellow fever virus epidemic in Central Brazil. 22 Environmental changes have been closely associated with arboviral epidemic widespread in Brazilian Amazon. OROV epidemics were associated with deforestation, colonization and unplanned urbanization 23,24 similar to changes occurring in the municipalities of Bragantina region involved in the present OROV epidemic, where large areas have been used for agricultural activities. The overall prevalence of OROV antibodies in Magalhães Barata (76.9%) and Maracanã (73.3%) suggest an occurrence of almost 18,000 infections in the two municipalities. These numbers are of a magnitude observed with serologic surveys in past Oropouche fever outbreaks and probably are underestimated. 2,5,20 The 26-year inter-epidemic period probably represents accumulation of OROV-susceptible people, especially among young inhabitants. Another factor is the influx of immigrants. Our survey in Magalhães Barata municipality showed that infection was most frequent among inhabitants aged ≤15 years old, which is in accordance with our expectation, since it is believed that many adults were infected and became immune to OROV during the 1979–1980 epidemic. In fact, 57.5% of all people infected during the present epidemic were less than 15 years of age. OROV genotype II was responsible for the epidemic in all municipalities where OROV was isolated. This genotype had been previously associated with Oropouche fever epidemics in focal western Amazon areas, particularly in Rondônia state, as well as in Peru. 8 Interestingly, it was the found that this genotype had been isolated in 2004 during a small outbreak in the Tapará county in Porto de Moz municipality, middle Pará State (which is at same distance between western and eastern Amazon region 18 and that it was genetically related to strains isolated in Peru during the 1990s and in Rondônia State in 1991. 8 This finding demonstrates an apparent intense transit of OROV genotype II across the Amazon region, from western to eastern areas. Acknowledgments We are grateful to the Secretaria Municipal de Saúde de Magalhães Barata for logistical assistance, as well as Geraldo M. Santos, Maria dos Anjos, Iveraldo F. da Silva, Maxwell F. de Lima, Basílio S. Buna, and Luiz R.O. Costa for their technical support during field collection, viral isolation process and serologic tests. This work was supported by IEC/SVS/Ministry of Health and the CNPq grant 300460/2005-8. References 1 C.M. Fauquet M.A. Mayo J. Maniloff U. Desselberger L.A. Ball Virus taxonomy: classification and nomenclature of viruses. Eighth report of the International Committee on the Taxonomy of Viruses 2005 Academic Press San Diego p. +1259 2 F.P. Pinheiro A.P.A. Travassos da Rosa J.F.S. Travassos da Rosa R. Ishak R.B. Freitas M.L.C. Gomes O.F.P. Oliva J.W. Le Duc Oropouche virus . I. A review of clinical, epidemiological, and ecological findings Am J Trop Med Hyg 30 1981 165 181 3 F.P. Pinheiro A.P.A. Travassos da Rosa P.F.C. Vasconcelos Oropouche fever R.D. Feigin Textbook of pediatric infectious diseases 5th ed. 2004 Saunders Philadelphia 2418 2423 4 C.R. Anderson L. Spence W.G. Downs T.H.G. Aitken Oropouche virus : a new human disease agent from Trinidad, West Indies Am J Trop Med Hyg 10 1961 574 578 5 F.P. Pinheiro M. Pinheiro G. Bensabath O.R. Causey R.E. Shope Epidemia de vírus Oropouche em Belém Rev Serv Esp Saúde Públ 12 1962 15 23 6 R.S.S. Azevedo M.R.S. Souza S.G. Rodrigues M.R.T. Nunes B.S. Buna R.N.Q. Leão P.F.C. Vasconcelos Ocorrência endêmica de febre por Oropouche em Belém/PA no período de 2000 a 2001 Rev Soc Bras Med Trop 35 Suppl. I 2002 386 7 D.M. Watts I. Phillips J.D. Callahan W. Griebenow C. Hyams C.G. Hayes Oropouche virus transmission in the Amazon River basin of Peru Am J Trop Med Hyg 56 1997 148 152 8 M.F. Saeed H. Wang M.R.T. Nunes P.F.C. Vasconcelos S.C. Weaver R.E. Shope D.M. Watts R.B. Tesh A.D.T. Barrett Nucleotide sequences and phylogeny of the nucleocapsid gene of Oropouche virus J Gen Virol 81 2000 743 748 9 M.R.T. Nunes L.C. Martins S.G. Rodrigues J.O. Chiang R.S.S. Azevedo A.P.A. Travassos da Rosa P.F.C. Vasconcelos Oropouche virus isolation, Southeast Brazil Emerg Infect Dis 11 2005 1610 1613 10 R.E. Shope G.E. Sather E.H. Lennette N.J. Schmidt Arboviruses diagnostic procedures for viral, rickettsial and chlamydial infections 1979 American Public Health Association Washington 767 814 11 D.H. Clarke J. Casals Techniques for hemagglutination and hemagglutination-inhibition with arthropod-borne viruses Am J Trop Med Hyg 7 1958 561 573 12 P.F.C. Vasconcelos J.F.S. Travassos da Rosa S.C. Guerreiro N. Dégallier E.S. Travassos da Rosa A.P.A. Travassos da rosa Primeiro registro de epidemias causadas pelo vírus Oropouche nos estados do Maranhão e Goiás, Brasil Rev Inst Med Trop São Paulo 31 1989 271 278 13 N. Saitou M. Nei The neighbor-joining method: a new method for reconstruction phylogenetic trees Mol Biol Evol 4 1987 406 425 14 D.L. Swofford PAUP. Phylogenetic Analysis Using Parsimony (and other methods), version 4 1998 Sinauer Associates Suderland, MA 15 S.K. Kumar M. Tamura S. Nei Molecular evolutionary genetic analysis. Version 1.01 2000 The Pennsylvania State University 16 J. Felsenstein Confidence limits on phylogenies: an approach using the bootstrap Evolution 39 1985 783 791 17 M. Weidmann V. Rudaz M.R.T. Nunes P.F.C. Vasconcelos F.T. Hufert Rapid detection of human orthobunyaviruses J Clin Microbiol 41 2003 3299 3305 18 R.S.S. Azevedo M.R.T. Nunes J.O. Chiang G. Bensabath H.B. Vasconcelos A.Y.N. Pinto L.C. Martins H.A.O. Monteiro S.G. Rodrigues P.F.C. Vasconcelos Reemergence of Oropouche fever in Northern Brazil Emerg Infect Dis 13 6 2007 912 915 19 D.M. Watts G. Ramirez C. Cabezas M.T. Wooster C. Carrillo M. Chuy Arthropod-borne viral diseases in Peru A.P.A. Travassos da Rosa P.F.C. Vasconcelos J.F.S. Travassos da Rosa An overview of arbovirology in Brazil and neighbouring countries 1998 Instituto Evandro Chagas Belém 193 218 20 R.B. Freitas F.P. Pinheiro M.A.V. Santos A.P.A. Travassos da Rosa J.F.S. Travassos da Rosa E.N. Freitas Epidemia de Oropouche no leste do Estado do Pará, 1979 F.P. Pinheiro International symposium on tropical arboviruses and haemorrhagic fevers 1982 Academia Brasileira de Ciências Rio de Janeiro 419 439 21 K.J. Linthicum A. Anyamba C.J. Tucker P.W. Kelley M.F. Myers C.J. Peters Climate and satellite indicators to forecast Rift Valley fever epidemics in Kenya Science 285 1999 397 400 22 P.F.C. Vasconcelos Z.G. Costa E.S. Travassos da Rosa E. Luna S.G. Rorigues V.L.R.S. Barros An epidemic of jungle Yellow fever in Brazil, 2000. Implications of climatic alterations in disease spread J Med Virol 65 3 2001 598 604 23 P.F.C. Vasconcelos A.P.A. Travassos da Rosa S.G. Rodrigues E.S. Travassos da Rosa N. Dégallier J.F.S. Travassos da Rosa Inadequate management of natural ecosystem in the Brazilian Amazon region results in the emergence of arboviruses Cad Saúde Pública 17 2001 155 164 24 J.A. Patz U.E.C. Confalonieri F.P. Amerasinghe K.B. Chua P. Daszak A.D. Hyatt Human health: ecosystem regulation of infectious diseases R. Hassan R. Scholes N. Ash Millennium ecosystem assessment: ecosystems and human well-being—volume 1 (current state and trends) 2005 Island Press Washington 391 415