Blocking Adhesion Of Sickle Erythrocytes To Endothelial Alpha V Beta 3 Using Rna Aptamer.

Abstract Vaso-occlusive crises are a major clinical feature of sickle cell disease (SCD), and the adhesion of sickle erythrocytes (SS-RBC) to vascular endothelium is crucial to the generation of vaso-occlusion. The αvβ3 integrin is a major endothelial ligand for SS-RBC. Soluble thrombospondin has been thought to serve as a bridging molecule between erythrocyte CD36 and endothelial αvβ3, and high-molecular-weight multimers of von Willebrand factor also promote SS-RBC adhesion to endothelial αvβ3. Our group recently identified SS-RBC adhesion to endothelium via ICAM-4 (LW, CD242)-αvβ3 interactions (Blood, 104, 3774, 2004), suggesting that αvβ3 is a critical target against which to develop reagents to prevent or treat vaso-occlusive crises in SCD. Aptamers are oligonucleotides that bind to molecular targets in a manner conceptually similar to antibodies and have been identified against a wide range of therapeutic targets. RNA aptamers that bind to human integrin αIIbβ3/αvβ3 and inhibit integrin binding to the ligands vitronectin and fibrinogen have previously been identified (Biochem Biophys Res Commun, 338, 956, 2005). We have now tested one of these high-affinity αvβ3 aptamers (clone 17.16: UUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCC) for its ability to prevent adhesion of SS-RBC to endothelial cells. Aptamer clone 17.16 bound αIIbβ3 with a Kd of 7–10nM, and the binding was blocked by both Abciximab, a monoclonal antibody against human integrin αIIbβ3/αvβ3 via a common binding motif RGD (arginine-glycine-aspardic acid), and Eptifibatide, a small molecule that binds to the RGD moiety, suggesting the sharing of the binding site at the RGD moiety. To measure its anti-adhesion activity, an in vitro flow chamber assay was adopted. We first induced enhanced expression of αvβ3 on the immortalized HUVEC cell line EC-RF24, using each of the following: TNF-α (10ng/mL for 18.5 hrs at 37°C), thrombin (1nM for 5 min at 37°C), or histamine (25mM for 12 min at RT), and αvβ3 expression by treated and nontreated cells was measured by flow cytometry. The anti-adhesion activity of aptamer clone 17.16 was then confirmed using HUVECs treated with thrombin (1nM for 5mins at 37°C) using a flow chamber assay. Aptamer clone 17.16 (30nM) had anti-adhesion activity similar to LM609, an inhibitory antibody to αvβ3, whereas human complement 8 aptamer (Blood, 106, 57a, 2005, negative control, 30nM) did not have anti-adhesion activity. The anti-adhesion activity of aptamer clone 17.16 (30nM) was enhanced by a dose escalation to 60nM and 120nM. At 2 dynes/cm2, maximal inhibition of adhesion was 57%. In conclusion, we observed significant anti-adhesion activity of αvβ3 aptamer clone 17.16, and it has currently reached a stage suitable for modification to enhance stability and bioavailability. In addition, in vivo experiments in mice will employ intravital microscopy to measure anti-adhesion activity in vivo. Figure Figure