WeChat Mini Program
Old Version Features

    • Correction for Quer at Al., High-Resolution Hepatitis C Virus Subtyping Using NS5B Deep Sequencing and Phylogeny, an Alternative to Current Methods

    Journal of Clinical Microbiology（2016）

    HUVH

    Cited 80|Views44
    Abstract
    Volume 53, no. 1, p. [219–226][1], 2015. Page 221, Table 1: The sequence for primer 13N5Bo8254 should read “GTTGTAAAACGACGGCCAGT CNTAYGAYACCMGNTGYTTTGACTC .” [1]: /lookup/doi/10.1128/JCM.02093-14
    More
    Translated text
    Key words
    Hepatitis C Virus
    PDF
    View via Publisher
    Bibtex
    AI Read Science
    Must-Reading Tree
    Example
    Generate MRT to find the research sequence of this paper
    Data Disclaimer
    The page data are from open Internet sources, cooperative publishers and automatic analysis results through AI technology. We do not make any commitments and guarantees for the validity, accuracy, correctness, reliability, completeness and timeliness of the page data. If you have any questions, please contact us by email: report@aminer.cn
    Chat Paper
    Summary is being generated by the instructions you defined